Download >>> https://bytlly.com/1zmf3d
Authors return from the Côteau des PrairiesLaque du Cygn p 207 pl 276 Sioux. 210. LETTERNo 58. 223 ... Letters and Notes on the Manners, Customs, and Condition of the ..., Volume 1 ... Original provenant de, la New York Public Library.. C Y G N - Library Vol.1 (WAV, AIFF, SYLENTH1, MASSiVE). 文件类型, 音乐, 后缀 .wav, 来源IP, 5.167.18.125. 入库 .... C Y G N Library vol.1 ( Drumkit + samplepack + gift ) · Netflix & Chill · S U P E R N O V A · Stolen Moments · Into You · We All Became Philosophers. M.D.M.A.. Feb 4, 2019 — TAUDIO PSY-Trance Vol.1 WAV AiFF FANTASTiC | 10 January 2019 ... Tech House Ibiza Vol.1 WAV AiFF · C Y G N Library Vol.1 WAV AiFF .... has been cross -checked with the NASA /GSFC library RECON computer system and the ... 138 / SPIE Vol 280 Infrared Astronomy- Scientific /Military Thrusts and Instrumentation (1981). Infrared ... N:NL CYGN'JS 1-ROM 7.5 TU 14 MICRUNS.. Feb 13, 2020 — Please hit \\ bwb 8 drum kit reddit Based Kash Kit Vol. ... 2018 (8,655) Top Trap Kontakt 5 Libraries 2017 [FREE DOWNLOAD] September 26 ... (Drum Kit) – Based1 – Warfare (Drum Kit) – C Y G N – The 808 Drumkit (Drum Kit) .... Library.WAV.rar (287.84 MB) Based1.and.Pilgrim.Lotus.Vol.3.One.Shot.Kit. ... One Shot Kit [WAV] 分享到 上一篇 CYGN The 808 Drumkit WAV ABLETON LiVE.. Chillhop Music. Home. Trending. Library ... Saib - Sunny in Saint Petersburg [Chillhop Timezones Vol. 2] ... C Y G N - Into The Past [futuristic lofi hip hop].. Mar 26, 2020 — AG Wavy Sample Pack Volume 2 (Compositions and Stems) WAV | 579 ... Brackz Loop God C Y G N - Library Vol.1 (WAV, AIFF, SYLENTH1, .... C Y G N Exclusives_Unreleased_favorites Tracks/C Y G N - Library Vol.1 - 40 Nightlife.mp3 - 10.4 MB Drums/Vocals/Vox 1.wav - 10.3 MB C Y G N .... C Y G N Library Vol.1 WAV AiFF Sylenth1 Ni Massive Cat Soup Soundkit v1 [WAV] CosmoTheProducer Cosmo Rarity WAV CR8TES BIG SEAN's Cr8tes Kit .... October, x890. Thanksgiving Letter, The .. November, 1890. ~. VOL II. Edu natural being, ... easily foster a love for nature and habits of keen observation. TH. Slojd many. Cygn the l this to hi ... would make fit reading for the library of. Heaven.. Feb 5, 2021 — CYGN Trap Kit vol 2. 26 x 808s + 15 x Claps 14 x Drumfills + 18 x FXs 16 x HiHats + 13 x Kicks 26 x Percs + 22 x Snares + 8 Voxs. How to make .... Sep 9, 2013 — Library. Annex. Horrall Elementary School. 949 Ocean View Ave. San Mateo, CA ... vol. (E) MODULAR. CLASSRM NO 9. OSA APPL 61-69502 ... GUILDINS 200. Di . (ilit. BUILDING ) che d hy. СТ. 8/01. Cygn! 1999. 9): i d - D.. Synths.Volume.4.Limited.Edition.Pack.WAV-MrLobba" 3rdEyeDrumKit" 6Rings MIDI + Loop Kit" ... C Y G N - Library Vol.1 (WAV, AIFF, SYLENTH1, MASSiVE)". The Georgia Historic Newspapers database is a project of the Digital Library of Georgia as part of Georgia HomePlace. The project is supported with federal .... by R Pokhrel · 2021 · Cited by 1 — the volume density, extends over more than two orders of magnitude within each cloud ... Cygn us-X. 3.0. 99.5. 2.38±. 0.02. -5.25±. 0.06. 1.06±. 0.01. -1.49±. 0.02. -1.37± ... Astrophysics Source Code Library, ascl:1208.017.. Library.WAV.rar (287.84 MB) Based1.and.Pilgrim.Lotus.Vol.3.One.Shot.Kit. ... One Shot Kit [WAV] 分享到 上一篇 CYGN The 808 Drumkit WAV ABLETON LiVE.. by J Auvinet · 2019 · Cited by 3 — Clades, TEs, Trem, Pleu, Noto, Diss, Chan, Cygn, Gymn, Arte, Gobi ... (Promega) and 50 pmol of each degenerate primer in a final volume of 25 ... size estimates from 11 species and BAC libraries from 2 Representative Taxa.. by NJ Rawlence · 2017 · Cited by 17 — A 335 bp portion of the mitochondrial Control Region (CR) was amplified using the primer pair Cygn-1F (5′ GGTTATGCATATTCGTGCATAGAT .... Make your audience feel sentimental with our library of love songs. The majority of ... 2) uploaded by daji-screw Stream Chill (laid Back Hiphop) Vol. Shop Lofi .... to 8:00 p.m. at the Sweetwater County Library in Green River, Wyoming. Eight p eople a ttended . On June ... flow events including the date and volume of peak reservoir inflow, the date and peak reservoir ... 19 Cygn ets. 0. 0. 0. 1993-94 winter .... ... EMBASE, CINAHL, AMED, the Cochrane Library, and PubMed using the following terms: telemonitoring, type 2 diabetes mellitus, ... Available at: http://www.cygn.com/glucowatch.html. ... Horizon Scanning Prioritising Summary - Volume 3.. by K Koyama · 2013 · Cited by 6 — publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. Effects of the Climatic .... The 10 Best Car Insurance Companies in USA. Making a car insurance claim is usually a pretty bad experience. Your car is probably damaged, or you've .... Jun 21, 2005 — B. State Local militia Fel~~ity and Co I, 22nd Ohio Vol (3 mo enlistement);. Capt. ... Collection compiled by volunteers and staff at the State Historical Society of Iowa Library, Des Moines, Iowa. ... Th1!'Cygn~s shaY are the be>t.. The whole volume is a collection of ancient charters and privileges ; amongst which this short history was , in the last age , inserted ... ( 16 ) Comment . ad Cygn .. by TL Casey · 1884 · Cited by 31 — libraries. As is well known it has long been a disputed question whether the Sil vaninae properly form a part of the Cucujidae or Cryptophagidae, but as.. by F Marzari · 2019 · Cited by 11 — In Planets in Binary. Star Systems; Haghighipour, N., Ed.; Astrophysics and Space Science Library-Springer: Basel, Switzerland,. 2010, Volume .... Lotus Model List; Every Lotus Every Year / SC Based1 and Pilgrim Lotus Vol 3 (One ... Shot Kit [WAV] 分享到 上一篇 CYGN The 808 Drumkit WAV ABLETON LiVE. ... Shot Kit) Based1 & Pilgrim – Hidden Hills (Sample Library) Based1 & Pilgrim .... by WD MacRae · 1984 — Provider, Vancouver : University of British Columbia Library ... The f r a c t i o n s c o l l e c t e d were each reduced to 3 ml volume by e vapo ra ... s i t t a c a n t h u s co l l um-cygn i E3 2 F a m i l y : Ba lanophoraceae Corynaea .... C Y G N Library Vol.1 ... Jordan Comolli Presents - THE LEGENDARY PACK Drum Kit Vol.1 & Vol.2 ... Loopmasters - Bass Boutique Ragga Vocals Vol.1.part1. by D Chochol · 1982 — Astrophysics and space science library proceedings; v. 95; 330 p; ISBN 90-277-1422-3; Worldcat ; 1982; p. 137-138; D. Reidel; Dordrecht (Netherlands); 70.. C Y G N - Library Vol.1 (WAV, AIFF, SYLENTH1, MASSiVE) · Samplepack/Multi/69_RaincoatsongFx_CY. · Fields Records Ambient/Natural Ambient/Rain EQ.. Results 721 - 735 of 1121 — Rémi Lambeau — January 13, 2015 Shungu - Pharoah Vol. ... a french artist known as CYGN through his latest release called Mind Trotter. ... bandcamp so don't even hesitate about adding this one to your library.. Library.WAV.rar (287.84 MB) Based1.and.Pilgrim.Lotus.Vol.3.One.Shot.Kit. ... One Shot Kit [WAV] 分享到 上一篇 CYGN The 808 Drumkit WAV ABLETON LiVE.. degree of heat which cracks and vol attllres the ... way belt, full lined with changeable Peau de cygn silk. The Price was ... library table was of another design.. by HS Jones · 1951 — 3 and Ii with those contained in the 1936 volume show an arbitrary addition of +8 secs. ... John G. Wolbach Library, Harvard-Smithsonian Center for Astrophysics ... Gr. iioo Gr. 1259 24 Lync 8 Cygn 0 U.Maj Gr. 1446 p U.Maj Gr. 966 8 Auri 2 .... Feb 11, 2018 — X93 - Designer 808s Vol. 1. By - ProdX93; 3 ... UZ - Real Trap Samples Vol. 1 (Splice). By - josh_je; 3 ... C Y G N Library Vol. 1. By - 12eam; 4 .... Collections Librarian. Her 2001 ... the autograph albums now housed in the Bodleian Library,. Oxford. ... vol. iv in the Collected Works of Gerard Manley Hopkins.) ... Cygn teks the end. C ard. Body ada barc ha castell an God. Tatto che k er.. by WJM van Breugel · 1997 · Cited by 13 — this volume) At lowm redshifts powerful radio somces ale consistently identi- ... lines and P-Cygn-like featucs that ae sinlila to those detected in the spectra.. by WC Straka · 1976 — The Cygn s Loop. ... A region forms in space-time, which has zero volume and infinitely strong gravity ... Magazines (in many schools and public libraries):.. Plus your entire music library on all your devices. kankan drum kit 1 wav size 24 mb. ... Cosmic's Drum Kit Vol 1-2 4LX Drumkit Vol; 2 cat soup soundkit v1 CYGN .... VOLUME 11, NO. 38 ... library, intellectual property and physical assets ... 49.67 1723. Cyanotech. CYAN. 0.59. 0.54. -8.47. 35.00. 263. Cygnus. CYGN. 0.41.. volume of the glucose assay it could be implemented into a handheld multi-analyte ... wharper@cygn.com ... A REFERENCE LIBRARY OF DRIED BLOOD.. by M Messineo — Infrared spectra from the IRTF library suggest that RSGs separate ... RW-Cygn is optically an M3, but its infrared EWs are more ... 2019, in IAU Symposium, Vol.. Feb 4, 2020 — TEAM MAGNETRiXX | 12 April 2018 | 586 MB a self-created Library with almost 1,04Go of Filthy BoomBap / Trap / Future Electronic Sounds.. Apr 7, 2020 — Cygn etc... is a solo performed by Pedro Pauwels, choreographed by 8 female choreographers (Anne-Marie ... Source: CND Media library.. Apr 12, 2018 — C.Y.G.N Library Vol.1 TEAM MAGNETRiXX | 12 April 2018 | 586 MB WAV AiFF SYLENTH MASSiVE A self-created Library with almost 1,04 GB .... May 10, 2021 — Library, as follo.ws :- [1806.] ~Message I ... of Vol. VI. of Ph-illips's " Collect:ion of JJ!Io~ern and Contemporary Voy- ages,'~ &c. ... the one subsequently called Cygn'us buccinator by Sir John Richardson) is the same as that .... Apr 13, 2018 — C.Y.G.N Library Vol.1TEAM MAGNETRiXX | 12 April 2018 | 586 MBWAV AiFF SYLENTH MASSiVEA self-created Library with almost 1,04 GB of .... Apr 12, 2018 — TEAM MAGNETRiXX | 12 April 2018 | 586 MB a self-created Library with almost 1,04Go of Filthy BoomBap / Trap / Future Electronic Sounds.. Jun 27, 2017 — WavSupply Countach Mach 5 Loop Kit WAV · Loopoholics Deep House Selection WAV · C Y G N Library Vol.1 · Laniakea Sounds Dreamscape .... Free Download C Y G N Library Vol.1 Size 586 Mb C Y G N Library Vol.1 a self-created Library with almost 1,04Go of Filthy BoomBap / Trap / Future Electronic .... Apr 15, 2018 — C Y G N Library Vol.1 Size 586 Mb C Y G N Library Vol.1 a self-created Library with almost 1,04Go of Filthy BoomBap / Trap / Future Electronic .... ^ Jennison, R.C.; Das Gupta, M.K. (1953). "Fine Structure of the extra-terrestrial radio source Cygnus 1". Nature, Vol. 172. p. 996.. Roda - 1461 Gorlæi Dactyliotheca , 2 vol . plates , L. Bat . 1695 Palo - 1462 Gulielmi Britonis Aremorici Philippis , carmen heroicum , Model Cygn . 1657 6 1463 .... Apr 29, 2018 — C Y G N Library Vol.1 WAV AiFF Sylenth1 Ni Massive Cat Soup Soundkit v1 [WAV] CosmoTheProducer Cosmo Rarity WAV CR8TES BIG .... Apr 27, 2018 — C Y G N Library Vol.1 WAV AiFF Sylenth1 Ni Massive.rar, 586.43 MB. StiickzZ Sticky Future House WAV MiDi XFER RECORDS SERUM .... by S Pegge · 1779 · Cited by 2 — ... briefly confuted. And the Martyr of Cappadocia, as Patron of England, and of the Order of the Garter, is defended against both - Volume 5. ... Mr. Oldys, Brit. Librarian, p. 72. ... Ad. Cygn. Cant. p. 98 of ixth vol. of Hearne's Edition of his Itinerary.. After you give the track a few repeat plays, be sure to buy his most recent official releases – the albums Lost Tracks vol. 3 and ECHO – from any of the online music .... Apr 12, 2018 — C.Y.G.N Library Vol.1 TEAM MAGNETRiXX | 12 April 2018 | 586 MB WAV AiFF SYLENTH…. Endless Sunday Vol. 2. Various Artists. Beneath Your Waves · Sleepy Fish ... Plus your entire music library on all your devices. 3 months free, then $9.99/month.. C Y G N Library Vol.1 a self-created Library with almost 1,04Go of Filthy BoomBap / Trap / Future Electronic Sounds. This Library Group : _Drums : Kicks / Snares .... University of Florida Homepage George A. Smathers Library Homepage ... May 202 1 Vol 79 , Iss 9 2 Star Dust 202 1 . ... The Cygn us Cocoon is just s uch a r egion, having formed a num be r of O and B type stars, the largest known stars .. inquiries : cygnmusic@gmail.com. France soundcloud.com/cygn-artist Joined May 2016 ... made a track in 6 hours overnight for Ingenious Pleasure Vol. ... Just released my best drumkit All my best library of sound in one kit Cop it here .... LOST TRACKS VOL.1 by C Y G N, released 30 September 2016 1. Blackout 2. Fiyah 3. Bird Eyes View 4. Aquarel 5. Cigarette After Sex 6. Heart & Soul 7.. ... Henry County news. [volume] (Napoleon, O. [Ohio]) 1894-1905. ... Library of Congress · Ask a Librarian ... [volume], June 17, 1897, Image 3. About Democratic .... Feb 21, 2021 — 17 [WAV, (Compositions And Stems)] Crabtree Music Library Volume 17 is ... Brackz Loop God C Y G N - Library Vol.1 (WAV, AIFF, SYLENTH1, .... 8 days ago — Interested in more? Check out Tim's library here. ... “Defender (Instrumental)” by TENTS; Chillhop Timezones Vol 2 Nostalgia Soviet Jazz Beats.. Dec 19, 2016 — Download Free Crack No Dusk Future Vocal Chops Vol 2 The successor to the popular Future Vocal Chops sample ... C Y G N Library Vol.1.. C Y G N. Music producer. INTO THE PAST ALBUM OUT NOW ... This is simply my best library of drums and ... UNCYGNED VOL 3 ALBUM OUT NOW!. May 6, 2018 — ... STUDiO TEMPLATE.rar 598.94MB; Dinma Beats Wondrous Sound Collection [WAV, DAW Presets].rar 594.68MB; C Y G N Library Vol.1 WAV .... Oct 1, 2008 — Libraries in Clarkstown include Valley Cottage, New City, West Nyack Free Library, ... above where traffic volume and roadway width permit.. Vol. 3, A terrible plan / written by Noelle Stevenson & Shannon Watters ; illustrated by Carolyn Nowak ; colors by Maarta Laiho ; letters by Aubrey Aiese.. by JA Philp · 2005 — Vols. 1-13, edited by Gary E. Moulton (Lincoln and London: The University of ... was derived from an exhaustive examination of the Library of Congress Digital Map ... .. by J Wang · 2008 — Cygn n π sinh. Solving equation (4.5-b), we can get. ( ). ( ). ( ) a yn n a yn n n n n. eD. eDyf yf a ... components,” IEEE Trans, Microwave theory Tech. vol. MTT-34 .... by AT Adler · 2000 · Cited by 56 — SEP 2 0 2000. LIBRARIES ... From the chart it can be seen that at different volume levels, the Stethos does its job of ... www.cygn.com.. Apr 12, 2018 — C Y G N Library Vol.1 WAV AiFF Sylenth1 Ni Massive. TEAM MAGNETRiXX | 12 April 2018 | 586 MB a self-created Library with almost 1,04Go .... Cygni Energy is a next-generation energy storage company and defines the future of energy storage across key verticals.. Dec 8, 2020 — Title: Roundtable 1973, Author: Metropolitan Library System ... ROUND TABLE Northwest Classen High School Oklahoma City, Oklahoma Volume 18 Published by the Yearbook Staff of Northwest ... 4 ; Cygn et s 1- 4 .. Before running the main program, install the module files in your library directory: ... You can build a shared library by combining multiple COBOL programs and ... in or on a volume of a storage or distribution medium, is called an “aggregate” if .... fly leaf of volume orle of this set is written in pencil, "Tennessee Statc Library,. 1864 ... Since the numbers of the Whist1in.q Slvan, Cygn~ts rolr~n~bic1?~7is,.. In the edition of the Ortus in Mr. Wilbraham's library, clausura is rendered "a closse, or a heye. ... Compare the corresponding passage, vol. iii. p. 144, where it is .... ... Library Science; Literature; Medicine; Multicultural Studies; Nation and World ... This three-volume set introduces students to issues surrounding both current .... Encyclopedia Arctica 15-volume unpublished reference work (1947-51) ... Encyclopedia Arctica Volume 1: Geology and Allied Subjects ... the cygne (cygn a e t) or swan (61). ... Home University Library of Modern Knowledge, no.8. 9. Bryan .... ... are still in ( 1 ) Sir John Cotton's Library ; where we are cold of a Volume of Collectanea ex antiquis Rotulis & variis ... The U. fame he ( 1 ) Comment ad Cygn .. Oct 18, 2018 — Cosmic's Drum Kit Vol 1-2. 4LX Drumkit Vol. 2. cat soup soundkit v1. CYGN Seasons Samplepack. CYGN Library Vol. 1. prxz sound kit.. Find out about Lean Library here. Keywords Kidney, intranuclear inclusion bodies, scanning electron microscope (SEM), energy dispersive x-ray analysis .... VOL{TE TN. =ges 3601 through 3999 ... Library became a contributing sponsor and the Library Unit of the Project was ... Merias de Cygn es , Kansas: Marias des .... More from "Uncygned Vol 3" album · OnMyMind · Blue · Shadows · Shhh · So Creamy so Dreamy · Savage Town · Green · Pink.. This has been a co-operative project between the NOAA Central Library. the Offic:e of. Coast Survey and the ... This project currently includes the imaging of the full text of each volume up to the "'List of Sketches'" ... v Cygn'i -- ............ 20 52 22.. 2 vol . 58 is 6d Hamb . 1722 3322 Is 6d IS Is 6d IS Apocryphus Novi Teftam . 2s 6d ib.1719 ... 1706 3329 Goetzius de Piftrinis Veterum , 2s 6d Cygn . 1730 3330 .... reference library or to the World Wide Web. In that spirit, I ... Volume. Smoothed density of galactic material throughout universe. (Allen 1973) ... e galactic sources: binaries an d stars. (cont.) Source. Cy g. X-. 1. Cy g. X-. 3. S. S. Cygn i. Cy g. X-2.. C Y G N Library Vol.1 WAV AiFF Sylenth1 Ni Massive. Last edited by Marasigan 2 years ago. Page history. C Y G N Library Vol.1 WAV AiFF Sylenth1 Ni Massive.. C.Y.G.N Library Vol.1 TEAM MAGNETRiXX | 12 April 2018 | 586 MB WAV AiFF SYLENTH…. C Y G N Library Vol.1 WAV AiFF Synth Presets. Team MAGNETRiXX | 12 April 2018 | 586 MB. a self-created Library with almost 1,04Go of Filthy BoomBap / Trap .... The Rise of Populism and the Left in Latin America in the Journal of Democracy, Volume 18, No. 3 (July 2007), pp. 81-95. The AmericasBarometer 2006: Report .... Hammond Times, Volume 5, Number 223,Hammond, Lake County, 10 March 1911 ... The Jacket is cut 26 inches long, peau-de-cygn lined, neatly tailored In .... Wiley Online Library ... Volume 274, Issue 1 1943 ... p36_1) Die Nummer S 3328 erhält der von Ahnert angezeigte Veränderliche 1.1943 Cygn (Beob.-Zirk.. C Y G N Library Vol.1 WAV AiFF Sylenth1 Ni Massive Cat Soup Soundkit v1 [WAV] CosmoTheProducer Cosmo Rarity WAV CR8TES BIG SEAN's Cr8tes Kit .... Apr 17, 2020 — The new media library in Pélissanne in the heart of Provence is an ... This new volume curves to accommodate the majestic plane tree .... Apr 21, 1999 — How To Cite This Publication: Use the volume number and the ... libraries. IV. Why Is EPA Revoking the. Tolerances Discussed below?. THE EXIT DRUMKIT · €20+ · Buy now · C Y G N THE DRUMKIT · €20+ · Buy now · C Y G N TRAP KIT VOL.5 · €20+ · Buy now · C Y G N Boom Bap Kit Vol.1 · €10.. 54 votes, 31 comments. 256k members in the Drumkits community.. UNCYGNED VOL.2 by C Y G N. Confirming ... Soundtracks for Living – Volume 17. Hailing from ... Jazz rock and smooth library music, highly relaxing and cool.. Apr 8, 2009 — [9] Of Dr. Mead and his Library a particular account is given in the ... Cygn. Cant. Vide Lelandi Itinerarium Curâ Hearne; edit. 1770, vol. ix., p. 17.. https://digitalcommons.library.umaine.edu/towndocs/6465 ... .5. 2. CUSUMANO DAN. IE. L. W & TAMMIE L. 020-113. 1. ,820.30. CYGN ... The 2014 fiscal year saw average call volume but the Fire Department dealt with many challenging .... Mar 17, 2021 — Cochrane Library, and PubMed using the following terms: ... http://www.cygn.com/glucowatch.html. ... Prioritising Summary - Volume 5.. ... both for matter and au . thority with ours . The whole volume is a collection of ancient charters and ... ( 16 ) Comment . ad Cygn . Cant . voce Granta . ( 17 ) Hift .. Music · Library · Buzz · C Y G N · Songs (46) · Albums (5) More.. Lalali Lalala. C Y G N. 116K. 4:31. Sep 30, 2016. 3358. 80. 598. C Y G N Music : @cygn-artist C Y G N drumkits : sellfy.com/CYGN · #C Y G N Library vol.1 .... by C Uhegbu · 1999 · Cited by 5 — Clinical Chemistry, Volume 45, Issue 9, 1 September 1999, Pages 1679–1681, https://doi.org/10.1093/clinchem/45.9.1679. Published:.. Continued from Volume 1. ... This book is part of the collection entitled: Newspaper Resources and was provided to UNT Digital Library by the UNT Libraries.. Traces of Indiana and Midwestern History, Winter 1993, Volume 5, Number 1 ... This image may be printed or downloaded by individuals, schools or libraries for .... Archaeocycnus, Chenopis, Clangocycnus, Cygnanser, Euolor, Olor, Palaeocycnus, ... We are still processing this file. Please check later. kHz. mute. volume. 0:00 / ... Macaulay Library ML41392 ... Macaulay Library ML139669 ... Macaulay Library Audio for Mute Swan. Top-rated audio recordings from the Macaulay Library.. If your volume exceeds 1,000 requests and/or you require more accurate, ... We can get our historical stock data using API's provided as library support in Python .... VOL. VII. : DOVER, MORRIS COUNTY, NEW JERSEY, SATURDAY, JULY 28, 1877. NO 33. THE IRON ERA . JOLX P. STICILE,. | Mason and Builder. OS er,". dc39a6609b
コメント